extractVRegion - Extracts FWRs and CDRs from IMGT-gapped sequences

Description

extractVRegion extracts the framework and complementarity determining regions of the V-segment for IMGT-gapped immunoglobulin (Ig) nucleotide sequences according to the IMGT numbering scheme.

Usage

extractVRegion(sequences, region = c("FWR1", "CDR1", "FWR2", "CDR2", "FWR3"))

Arguments

sequences
character vector of IMGT-gapped nucleotide sequences.
region
string defining the region(s) of the V-segment to extract. May be a single region or multiple regions (as a vector) from c("FWR1", "CDR1", "FWR2", "CDR2" ,"FWR3"). By default, all regions will be returned.

Value

If only one region is specified in the region argument, a character vector of the extracted sub-sequences will be returned. If multiple regions are specified, then a character matrix will be returned with columns corresponding to the specified regions and a row for each entry in sequences.

References

  1. Lefranc M-P, et al. IMGT unique numbering for immunoglobulin and T cell receptor variable domains and Ig superfamily V-like domains. Dev Comp Immunol. 2003 27(1):55-77.

Examples

# Assign example clone
clone <- subset(ExampleDb, CLONE == 3138)

# Get all regions
extractVRegion(clone$SEQUENCE_IMGT)

      FWR1                                                                             CDR1                                  
 [1,] "GAGGTGCAGCTGGTGGTCTCTGGGGGA...GGCTTGGTACAGCCAGGGCGGTCCCTAAGACTCTCCTGTACAGTTTCT" "GGATTCACCTTT............GGTGATTATGCT"
 [2,] "GAAGTGCAACTGGTGGTCTCTGGGGGA...GGCTTGGTACAGCCAGGGCGGTCCCTAAGACTCTCCTGTACAGTTTCT" "GGATTCACCTTT............GCTGATTATGCT"
 [3,] "GAGGTGCAGCTGGTGGTCTCTGGGGGA...GGCTTGGTACAGCCAGGGCGGTCCCTAAGACTCTCCTGTACAGTTTCT" "GGATTCACCTTT............GGTGATTATGCT"
 [4,] "GAGGTGCAGCTGGTGGTATCTGGGGGA...GGCTTGGTACAGCCAGGGCGGTCCCTAAGACTCTCCTGTACAGTTTCT" "GGATTCACCTTT............GGTGATTATGCT"
 [5,] "GAAGTGCAACTGGTGGTCTCTGGGGGA...GGCTTGGTACAGCCAGGGCGGTCCCTAAGACTCTCCTGTACAGTTTCT" "GGATTCACCTTT............GCTGATTATGCT"
 [6,] "GAAGTGCAACTGGTGGTCTCTGGGGGA...GGCTTGGTACAGCCAGGGCGGTCCCTAAGACTCTCCTGTACAGTTTCT" "GGATTCACCTTT............GCTGATTATGCT"
 [7,] "GAGGTGCAGCTGGTGGTCTCTGGGGGA...GGCTTGGTACAGCCAGGGCGGTCCCTAAGACTCTCCTGTACAGTTTCT" "GGATTCACCTTT............GGTGATTACGCT"
 [8,] "GAGGTGCAGCTGGTGGTCTCTGG.GGA...GGCTTGGTACAGCCAGGGCGGTCCCTAAGACTCTCCTGTACAGTTTCT" "GGATTCACCTTT............GGTGATTATGCT"
 [9,] "GAGGTGCAGCTGGTGGTCTCTGGGGGA...GGCTTGGTACAGCCAGGGCGGTCCCTAAGACTCTCCTGTACAGTTTCT" "GGATTCACCTTT............GGTGATTACGCT"
[10,] "GAAGTGCAACTGGTGGTCTCTGG.GGA...GGCTTGGTACAGCCAGGGCGGTCCCTAAGACTCTCCTGTACAGTTTCT" "GGATTCACCTTT............GCTGATTATGCT"
[11,] "GAGGTGCAGCTGGTGGTCTCTGGGGGA...GGCTTGGTACAGCCAGGGCGATCCCTAAGACTCTCCTGTACAGTTTCT" "GGATTCACCTTT............GGTGATTATGCT"
[12,] "GAAGTGCAACTGGTGGTCTCTGGGGGA...GGCTTGGTACAGCCAGGGCGGTCCCTAAGACTCTCCTGTACAGTTTCT" "GGATTCACCTTT............GCTGATTATGCT"
[13,] "GAGGTGCAGCTGGTGGTATCTGGGGGA...GGCTTGGTACAGCCAGGGCGGTCCCTAAGACTCTCCTGTACAGTTTCT" "GGATTCACCTTT............GGTGATTATGCT"
[14,] "GAGGTGCAGCTGGTGGTCTCTGGGGGA...GGCTTGGTACAGCCAGGGCGGTCCCTAAGACTCTCCTGTACAGTTTCT" "GGATTCACCTTT............GGTGATTACGCT"
[15,] "GAGGTGCAGCTGGTGGTCTCTGGGGGA...GGCTTGGTACAGCCAGGGCGGTCCCTAAGACTCTCCTGTACAGTTTCT" "GGATTCACCTTT............GGTGATTATGCT"
[16,] "GAGGTGCAGCTGGTGGTCTCTGGGGGA...GGCTTGGTACAGCCAGGGCGGTCCCTAAGACTCTCCTGTACAGTTTCT" "GGATTCACCTTT............GGTGATTATGCT"
[17,] "GAGGTGCAGCTGGTGGTCTCTGGGGGA...GGCTTGGTACAGCCAGGGCGGTCCCTAAGACTCTCCTGTACAGTTTCT" "GGATTCACCTTT............GGTGATTATGCT"
[18,] "GAGGTGCAGCTGGTGGTCTCTGGGGGA...GGCTTGGTACAGCCAGGGCGGTCCCTAAGACTCTCCTGTACAGTTTCT" "GGATTCACCTTT............GGTGATTATGCT"
[19,] "GAAGTGCAACTGGTGGTCTCTGGGGGA...GGCTTGGTACAGCCAGGGCGGTCCCTAAGACTCTCCTGTACAGTTTCT" "GGATTCACCTTT............GCTGATTATGCT"
[20,] "GAGGTGCAGCTGGTGGTATCTGGGGGA...GGCTTGGTACAGCCAGGGCGGTCCCTAAGACTCTCCTGTACAGTTTCT" "GGATTCACCTTT............GGTGATTATGCT"
      FWR2                                                  CDR2                            
 [1,] "ATGACCTGGATCCGCCAGGCTCCTGGGAAGGGGCTGGAGTGGGTCGGGTTC" "ATTAGAAGCAAAACTTTTGGTGGGACAGCA"
 [2,] "ATGACTTGGATCCGCCAGGCTCCTGGGAAGGGGCTGGAGTGGGTCGGGTTC" "ATTAGAAGCAAAACTTTTGGTGGGACAGCA"
 [3,] "ATGACCTGGATCCGCCAGGCTCCTGGGAAGGGGCTGGAGTGGGTCGGGTTC" "ATTAGAAGCAAAACTTTTGGTGGGACAGCA"
 [4,] "ATGACCTGGATCCGCCAGGCTCCTGGGAAGGGGCTGGAGTGGGTAGGTTTC" "ATTAGAAGCAAAACTTTTGGTGGGACAGCA"
 [5,] "ATGACTTGGATCCGCCAGGCTCCTGGGAAGGGGCTGGAGTGGGTCGGGTTC" "ATTAGAAGCAAAACTTTTGGTGGGACAGCA"
 [6,] "ATGACTTGGATCCGCCAGGCTCCTGGGAAGGGGCTGGAGTGGGTCGGGTTC" "ATTAGAAGCAAAACTTTTGGTGGGACAGCA"
 [7,] "ATGACCTGGATCCGCCAGGCTCCTGGGAAGGGGCTGGAGTGGGTCGGGTTC" "ATTAGAAGCAAAACTTTTGGTGGGACAGCA"
 [8,] "ATGACCTGGATCCGCCAGGCTCCTGGGAAGGGGCTGGAGTGGGTCGGGTTC" "ATTAGAAGCAAAACTTTTGGTGGGACAGCA"
 [9,] "ATGACCTGGATCCGCCAGGCTCCTGGGAAGGGGCTGGAGTGGGTCGGGTTC" "ATTAGAAGCAAAACTTTTGGTGGGACAGCA"
[10,] "ATGACTTGGATCCGCCAGGCTCCTGGGAAGGGGCTGGAGTGGGTCGGGTTC" "ATTAGAAGCAAAACTTTTGGTGGGACAGCA"
[11,] "ATGACCTGGATCCGCCAGGCTCCTGGGAAGGGGCTGGAGTGGGTCGGGTTC" "ATTAGAAGCAAAACTTTTGGTGGGACAGCA"
[12,] "ATGACTTGGATCCGCCAGGCTCCTGGGAAGGGGCTGGAGTGGGTCGGGTTC" "ATTAGAAGCAAAACTTTTGGTGGGACAGCA"
[13,] "ATGACCTGGATCCGCCAGGCTCCTGGGAAGGGGCTGGAGTGGGTAGGTTTC" "ATTAGAAGCAAAACTTTTGGTGGGACAGCA"
[14,] "ATGACCTGGATCCGCCAGGCTCCTGGGAAGGGGCTGGAGTGGGTCGGGTTC" "ATTAGAAGCAAAACTTTTGGTGGGACAGCA"
[15,] "ATGACCTGGATCCGCCAGGCTCCTGGGAAGGGGCTGGAGTGGGTCGGGTTC" "ATTAGAAGCAAAACTTTTGGTGGGACAGCA"
[16,] "ATGACCTGGATCCGCCAGGCTCCTGGGAAGGGGCTGGAGTGGG.CGGGTTC" "ATTAGAAGCAAAACTTTTGGTGGGACAGCA"
[17,] "ATGACCTGGATCCGCCAGGCTCCTGGGAAGGGGCTGGAGTGGGTCGGGTTC" "ATTAGAAGCAAAACTTTTGGTGGGACAGCA"
[18,] "ATGACCTGGATCCGCCAGGCTCCTGGGAAGGGGCTGGAGTGGGTCGGGTTC" "ATTAGAAGCAAAACTTTTGGTGGGACAGCA"
[19,] "ATGACTTGGATCCGCCAGGCTCCTGGGAAGGGGCTGGAGTGGGTCGGGTTC" "ATTAGAAGCAAAACTTTTGGTGGGACAGCA"
[20,] "ATGACCTGGATCCGCCAGGCTCCTGGGAAGGGGCTGGAGTGGGTAGGTTTC" "ATTAGAAGCAAAACTTTTGGTGGGACAGCA"
      FWR3                                                                                                                   
 [1,] "GATTACGCCGCGTTTGTGAGA...GGCAGATTCACCATCTCAAGAGATGATTCCAAAAACATCGCCTATCTGCAATTGAACAGCCTGAAAACCGAGGACACAGGCGTCTATTACTGT"
 [2,] "GATTACGCCGCGTTTGTGAGA...GGCAGATTCACCATCTCAAGAGATGATTCCAAAAGCATCGCCTATCTGCAATTGAACAGCCTGGAAACCGACGACACAGGCGTCTATTACTGT"
 [3,] "GATTACGCCGCGTTTGTGAGA...GGCAGATTCACCATCTCAAGAGATGATTCCAAAAACATCGCCTATCTGCAATTGAACAGCCTGAAAACCGAGGACACAGGCGTCTATTACTGT"
 [4,] "GATTACGCCGCGTTTGTGAGA...GGCAGATTCACCATCTCAAGAGATGATTCCAAAAACATCGCCTATCTGCAATTGAACAGCCTGAAAACCGAGGACACAGGCGTCTATTACTGT"
 [5,] "GATTACGCCGCGTTTGTGAGA...GGCAGATTCACCATCTCAAGAGATGATTCCAAAAGCATCGCCTATCTGCAATTGAACAGCCTGGAAACCGACGACACAGGCGTCTATTACTGT"
 [6,] "GATTACGCCGCGTTTGTGAGA...GGCAGATTCACCATCTCAAGAGATGATTCCAAAAGCATCGCCTATCTGCAATTGAACAGCCTGGAAACCGACGACACAGGCGTCTATTACTGT"
 [7,] "GATTACGCCGCGTTTGTGAGA...GGCAGATTCACCATCTCAAGAGATGATTCCAAAAACATCGCCTATCTGCAATTGAACAGCCTGAAAACCGAGGACACAGGCGTCTATTACTGT"
 [8,] "GATTACGCCGCGTTTGTGAGA...GGCAGATTCACCATCTCAAGAGATGATTCCAAAAACATCGCCTATCTGCAATTGAACAGCCTGAAAACCGAGGACACAGGCGTCTATTACTGT"
 [9,] "GATTACGCCGCGTTTGTGAGA...GGCAGATTCACCATCTCAAGAGATGATTCCAAAAACATCGCCTATCTGCAATTGAACAGCCTGAAAACCGAGGACACAGGCGTCTATTACTGT"
[10,] "GATTACGCCGCGTTTGTGAGA...GGCAGATTCACCATCTCAAGAGATGATTCCAAAAGCATCGCCTATCTGCAATTGAACAGCCTGGAAACCGACGACACAGGCGTCTATTACTGT"
[11,] "GATTACGCCGCGTTTGTGAGA...GGCAGATTCACCATCTCAAGAGATGATTCCAAAAACATCGCCTATCTGCAATTGAACAGCCTGAAAACCGAGGACACAGGCGTCTATTACTGT"
[12,] "GATTACGCCGCGTTTGTGAGA...GGCAGATTCACCATCTCAAGAGATGATTCCAAAAGCATCGCCTATCTGCAATTGAACAGCCTGGAAACCGACGACACAGGCGTCTATTACTGT"
[13,] "GATTACGCCGCGTTTGTGAGA...GGCAGATTCACCATCTCAAGAGATGATTCCAAAAACATCGCCTATCTGCAATTGAACAGCCTGAAAACCGAGGACACAGGCGTCTATTACTGT"
[14,] "GATTACGCCGCGTTTGTGAGA...GGCAGATTCACCATCTCAAGAGATGATTCCAAAAACATCGCCTATCTGCAATTGAACAGCCTGAAAACCGAGGACACAGGCGTCTATTACTGT"
[15,] "GATTATGCCGCGTTTGTGAGA...GGCAGATTCACCATCTCAAGAGATGATTCCAAAAACATCGCCTATCTGCAATTGAACAGCCTGAAAACCGAGGACACAGGCGTCTATTACTGT"
[16,] "GATTACGCCGCGTTTGTGAGA...GGCAGATTCACCATCTCAAGAGATGATTCCAAAAACATCGCCTATCTGCAATTGAACAGCCTGAAAACCGAGGACACAGGCGTCTATTACTGT"
[17,] "GATTACGCCGCGTTTGTGAGA...GGCAGATTCACCATCTCAAGAGATGATTCCAAAAACATCGCCTATCTGCAATTGAACAGCCTGAAAACCGAGGACACAGGCGTCTATTACTGT"
[18,] "GATTACGCCGCGTTTGTGAGA...GGCAGATTCACCATCTCAAGAGATGATTCCAAAAACATCGCCTATCTGCAATTGAACAGCCTGAAAACCGAGGACACAGGCGTCTATTACTGT"
[19,] "GATTACGCCGCGTTTGTGAGA...GGCAGATTCACCATCTCAAGAGATGATTCCAAAAGCATCGCCTATCTGCAATTGAACAGCCTGGAAACCGACGACACAGGCGTCTATTACTGT"
[20,] "GATTACGCCGCGTTTGTGAGA...GGCAGATTCACCATCTCAAGAGATGATTCCAAAAACATCGCCTATCTGCAATTGAACAGCCTGAAAACCGAGGACACAGGCGTCTATTACTGT"


# Get single region
extractVRegion(clone$SEQUENCE_IMGT, "FWR1")

 [1] "GAGGTGCAGCTGGTGGTCTCTGGGGGA...GGCTTGGTACAGCCAGGGCGGTCCCTAAGACTCTCCTGTACAGTTTCT"
 [2] "GAAGTGCAACTGGTGGTCTCTGGGGGA...GGCTTGGTACAGCCAGGGCGGTCCCTAAGACTCTCCTGTACAGTTTCT"
 [3] "GAGGTGCAGCTGGTGGTCTCTGGGGGA...GGCTTGGTACAGCCAGGGCGGTCCCTAAGACTCTCCTGTACAGTTTCT"
 [4] "GAGGTGCAGCTGGTGGTATCTGGGGGA...GGCTTGGTACAGCCAGGGCGGTCCCTAAGACTCTCCTGTACAGTTTCT"
 [5] "GAAGTGCAACTGGTGGTCTCTGGGGGA...GGCTTGGTACAGCCAGGGCGGTCCCTAAGACTCTCCTGTACAGTTTCT"
 [6] "GAAGTGCAACTGGTGGTCTCTGGGGGA...GGCTTGGTACAGCCAGGGCGGTCCCTAAGACTCTCCTGTACAGTTTCT"
 [7] "GAGGTGCAGCTGGTGGTCTCTGGGGGA...GGCTTGGTACAGCCAGGGCGGTCCCTAAGACTCTCCTGTACAGTTTCT"
 [8] "GAGGTGCAGCTGGTGGTCTCTGG.GGA...GGCTTGGTACAGCCAGGGCGGTCCCTAAGACTCTCCTGTACAGTTTCT"
 [9] "GAGGTGCAGCTGGTGGTCTCTGGGGGA...GGCTTGGTACAGCCAGGGCGGTCCCTAAGACTCTCCTGTACAGTTTCT"
[10] "GAAGTGCAACTGGTGGTCTCTGG.GGA...GGCTTGGTACAGCCAGGGCGGTCCCTAAGACTCTCCTGTACAGTTTCT"
[11] "GAGGTGCAGCTGGTGGTCTCTGGGGGA...GGCTTGGTACAGCCAGGGCGATCCCTAAGACTCTCCTGTACAGTTTCT"
[12] "GAAGTGCAACTGGTGGTCTCTGGGGGA...GGCTTGGTACAGCCAGGGCGGTCCCTAAGACTCTCCTGTACAGTTTCT"
[13] "GAGGTGCAGCTGGTGGTATCTGGGGGA...GGCTTGGTACAGCCAGGGCGGTCCCTAAGACTCTCCTGTACAGTTTCT"
[14] "GAGGTGCAGCTGGTGGTCTCTGGGGGA...GGCTTGGTACAGCCAGGGCGGTCCCTAAGACTCTCCTGTACAGTTTCT"
[15] "GAGGTGCAGCTGGTGGTCTCTGGGGGA...GGCTTGGTACAGCCAGGGCGGTCCCTAAGACTCTCCTGTACAGTTTCT"
[16] "GAGGTGCAGCTGGTGGTCTCTGGGGGA...GGCTTGGTACAGCCAGGGCGGTCCCTAAGACTCTCCTGTACAGTTTCT"
[17] "GAGGTGCAGCTGGTGGTCTCTGGGGGA...GGCTTGGTACAGCCAGGGCGGTCCCTAAGACTCTCCTGTACAGTTTCT"
[18] "GAGGTGCAGCTGGTGGTCTCTGGGGGA...GGCTTGGTACAGCCAGGGCGGTCCCTAAGACTCTCCTGTACAGTTTCT"
[19] "GAAGTGCAACTGGTGGTCTCTGGGGGA...GGCTTGGTACAGCCAGGGCGGTCCCTAAGACTCTCCTGTACAGTTTCT"
[20] "GAGGTGCAGCTGGTGGTATCTGGGGGA...GGCTTGGTACAGCCAGGGCGGTCCCTAAGACTCTCCTGTACAGTTTCT"


# Get all CDRs
extractVRegion(clone$SEQUENCE_IMGT, c("CDR1", "CDR2"))

      CDR1                                   CDR2                            
 [1,] "GGATTCACCTTT............GGTGATTATGCT" "ATTAGAAGCAAAACTTTTGGTGGGACAGCA"
 [2,] "GGATTCACCTTT............GCTGATTATGCT" "ATTAGAAGCAAAACTTTTGGTGGGACAGCA"
 [3,] "GGATTCACCTTT............GGTGATTATGCT" "ATTAGAAGCAAAACTTTTGGTGGGACAGCA"
 [4,] "GGATTCACCTTT............GGTGATTATGCT" "ATTAGAAGCAAAACTTTTGGTGGGACAGCA"
 [5,] "GGATTCACCTTT............GCTGATTATGCT" "ATTAGAAGCAAAACTTTTGGTGGGACAGCA"
 [6,] "GGATTCACCTTT............GCTGATTATGCT" "ATTAGAAGCAAAACTTTTGGTGGGACAGCA"
 [7,] "GGATTCACCTTT............GGTGATTACGCT" "ATTAGAAGCAAAACTTTTGGTGGGACAGCA"
 [8,] "GGATTCACCTTT............GGTGATTATGCT" "ATTAGAAGCAAAACTTTTGGTGGGACAGCA"
 [9,] "GGATTCACCTTT............GGTGATTACGCT" "ATTAGAAGCAAAACTTTTGGTGGGACAGCA"
[10,] "GGATTCACCTTT............GCTGATTATGCT" "ATTAGAAGCAAAACTTTTGGTGGGACAGCA"
[11,] "GGATTCACCTTT............GGTGATTATGCT" "ATTAGAAGCAAAACTTTTGGTGGGACAGCA"
[12,] "GGATTCACCTTT............GCTGATTATGCT" "ATTAGAAGCAAAACTTTTGGTGGGACAGCA"
[13,] "GGATTCACCTTT............GGTGATTATGCT" "ATTAGAAGCAAAACTTTTGGTGGGACAGCA"
[14,] "GGATTCACCTTT............GGTGATTACGCT" "ATTAGAAGCAAAACTTTTGGTGGGACAGCA"
[15,] "GGATTCACCTTT............GGTGATTATGCT" "ATTAGAAGCAAAACTTTTGGTGGGACAGCA"
[16,] "GGATTCACCTTT............GGTGATTATGCT" "ATTAGAAGCAAAACTTTTGGTGGGACAGCA"
[17,] "GGATTCACCTTT............GGTGATTATGCT" "ATTAGAAGCAAAACTTTTGGTGGGACAGCA"
[18,] "GGATTCACCTTT............GGTGATTATGCT" "ATTAGAAGCAAAACTTTTGGTGGGACAGCA"
[19,] "GGATTCACCTTT............GCTGATTATGCT" "ATTAGAAGCAAAACTTTTGGTGGGACAGCA"
[20,] "GGATTCACCTTT............GGTGATTATGCT" "ATTAGAAGCAAAACTTTTGGTGGGACAGCA"


# Get all FWRs
extractVRegion(clone$SEQUENCE_IMGT, c("FWR1", "FWR2", "FWR3"))
      FWR1                                                                            
 [1,] "GAGGTGCAGCTGGTGGTCTCTGGGGGA...GGCTTGGTACAGCCAGGGCGGTCCCTAAGACTCTCCTGTACAGTTTCT"
 [2,] "GAAGTGCAACTGGTGGTCTCTGGGGGA...GGCTTGGTACAGCCAGGGCGGTCCCTAAGACTCTCCTGTACAGTTTCT"
 [3,] "GAGGTGCAGCTGGTGGTCTCTGGGGGA...GGCTTGGTACAGCCAGGGCGGTCCCTAAGACTCTCCTGTACAGTTTCT"
 [4,] "GAGGTGCAGCTGGTGGTATCTGGGGGA...GGCTTGGTACAGCCAGGGCGGTCCCTAAGACTCTCCTGTACAGTTTCT"
 [5,] "GAAGTGCAACTGGTGGTCTCTGGGGGA...GGCTTGGTACAGCCAGGGCGGTCCCTAAGACTCTCCTGTACAGTTTCT"
 [6,] "GAAGTGCAACTGGTGGTCTCTGGGGGA...GGCTTGGTACAGCCAGGGCGGTCCCTAAGACTCTCCTGTACAGTTTCT"
 [7,] "GAGGTGCAGCTGGTGGTCTCTGGGGGA...GGCTTGGTACAGCCAGGGCGGTCCCTAAGACTCTCCTGTACAGTTTCT"
 [8,] "GAGGTGCAGCTGGTGGTCTCTGG.GGA...GGCTTGGTACAGCCAGGGCGGTCCCTAAGACTCTCCTGTACAGTTTCT"
 [9,] "GAGGTGCAGCTGGTGGTCTCTGGGGGA...GGCTTGGTACAGCCAGGGCGGTCCCTAAGACTCTCCTGTACAGTTTCT"
[10,] "GAAGTGCAACTGGTGGTCTCTGG.GGA...GGCTTGGTACAGCCAGGGCGGTCCCTAAGACTCTCCTGTACAGTTTCT"
[11,] "GAGGTGCAGCTGGTGGTCTCTGGGGGA...GGCTTGGTACAGCCAGGGCGATCCCTAAGACTCTCCTGTACAGTTTCT"
[12,] "GAAGTGCAACTGGTGGTCTCTGGGGGA...GGCTTGGTACAGCCAGGGCGGTCCCTAAGACTCTCCTGTACAGTTTCT"
[13,] "GAGGTGCAGCTGGTGGTATCTGGGGGA...GGCTTGGTACAGCCAGGGCGGTCCCTAAGACTCTCCTGTACAGTTTCT"
[14,] "GAGGTGCAGCTGGTGGTCTCTGGGGGA...GGCTTGGTACAGCCAGGGCGGTCCCTAAGACTCTCCTGTACAGTTTCT"
[15,] "GAGGTGCAGCTGGTGGTCTCTGGGGGA...GGCTTGGTACAGCCAGGGCGGTCCCTAAGACTCTCCTGTACAGTTTCT"
[16,] "GAGGTGCAGCTGGTGGTCTCTGGGGGA...GGCTTGGTACAGCCAGGGCGGTCCCTAAGACTCTCCTGTACAGTTTCT"
[17,] "GAGGTGCAGCTGGTGGTCTCTGGGGGA...GGCTTGGTACAGCCAGGGCGGTCCCTAAGACTCTCCTGTACAGTTTCT"
[18,] "GAGGTGCAGCTGGTGGTCTCTGGGGGA...GGCTTGGTACAGCCAGGGCGGTCCCTAAGACTCTCCTGTACAGTTTCT"
[19,] "GAAGTGCAACTGGTGGTCTCTGGGGGA...GGCTTGGTACAGCCAGGGCGGTCCCTAAGACTCTCCTGTACAGTTTCT"
[20,] "GAGGTGCAGCTGGTGGTATCTGGGGGA...GGCTTGGTACAGCCAGGGCGGTCCCTAAGACTCTCCTGTACAGTTTCT"
      FWR2                                                 
 [1,] "ATGACCTGGATCCGCCAGGCTCCTGGGAAGGGGCTGGAGTGGGTCGGGTTC"
 [2,] "ATGACTTGGATCCGCCAGGCTCCTGGGAAGGGGCTGGAGTGGGTCGGGTTC"
 [3,] "ATGACCTGGATCCGCCAGGCTCCTGGGAAGGGGCTGGAGTGGGTCGGGTTC"
 [4,] "ATGACCTGGATCCGCCAGGCTCCTGGGAAGGGGCTGGAGTGGGTAGGTTTC"
 [5,] "ATGACTTGGATCCGCCAGGCTCCTGGGAAGGGGCTGGAGTGGGTCGGGTTC"
 [6,] "ATGACTTGGATCCGCCAGGCTCCTGGGAAGGGGCTGGAGTGGGTCGGGTTC"
 [7,] "ATGACCTGGATCCGCCAGGCTCCTGGGAAGGGGCTGGAGTGGGTCGGGTTC"
 [8,] "ATGACCTGGATCCGCCAGGCTCCTGGGAAGGGGCTGGAGTGGGTCGGGTTC"
 [9,] "ATGACCTGGATCCGCCAGGCTCCTGGGAAGGGGCTGGAGTGGGTCGGGTTC"
[10,] "ATGACTTGGATCCGCCAGGCTCCTGGGAAGGGGCTGGAGTGGGTCGGGTTC"
[11,] "ATGACCTGGATCCGCCAGGCTCCTGGGAAGGGGCTGGAGTGGGTCGGGTTC"
[12,] "ATGACTTGGATCCGCCAGGCTCCTGGGAAGGGGCTGGAGTGGGTCGGGTTC"
[13,] "ATGACCTGGATCCGCCAGGCTCCTGGGAAGGGGCTGGAGTGGGTAGGTTTC"
[14,] "ATGACCTGGATCCGCCAGGCTCCTGGGAAGGGGCTGGAGTGGGTCGGGTTC"
[15,] "ATGACCTGGATCCGCCAGGCTCCTGGGAAGGGGCTGGAGTGGGTCGGGTTC"
[16,] "ATGACCTGGATCCGCCAGGCTCCTGGGAAGGGGCTGGAGTGGG.CGGGTTC"
[17,] "ATGACCTGGATCCGCCAGGCTCCTGGGAAGGGGCTGGAGTGGGTCGGGTTC"
[18,] "ATGACCTGGATCCGCCAGGCTCCTGGGAAGGGGCTGGAGTGGGTCGGGTTC"
[19,] "ATGACTTGGATCCGCCAGGCTCCTGGGAAGGGGCTGGAGTGGGTCGGGTTC"
[20,] "ATGACCTGGATCCGCCAGGCTCCTGGGAAGGGGCTGGAGTGGGTAGGTTTC"
      FWR3                                                                                                                   
 [1,] "GATTACGCCGCGTTTGTGAGA...GGCAGATTCACCATCTCAAGAGATGATTCCAAAAACATCGCCTATCTGCAATTGAACAGCCTGAAAACCGAGGACACAGGCGTCTATTACTGT"
 [2,] "GATTACGCCGCGTTTGTGAGA...GGCAGATTCACCATCTCAAGAGATGATTCCAAAAGCATCGCCTATCTGCAATTGAACAGCCTGGAAACCGACGACACAGGCGTCTATTACTGT"
 [3,] "GATTACGCCGCGTTTGTGAGA...GGCAGATTCACCATCTCAAGAGATGATTCCAAAAACATCGCCTATCTGCAATTGAACAGCCTGAAAACCGAGGACACAGGCGTCTATTACTGT"
 [4,] "GATTACGCCGCGTTTGTGAGA...GGCAGATTCACCATCTCAAGAGATGATTCCAAAAACATCGCCTATCTGCAATTGAACAGCCTGAAAACCGAGGACACAGGCGTCTATTACTGT"
 [5,] "GATTACGCCGCGTTTGTGAGA...GGCAGATTCACCATCTCAAGAGATGATTCCAAAAGCATCGCCTATCTGCAATTGAACAGCCTGGAAACCGACGACACAGGCGTCTATTACTGT"
 [6,] "GATTACGCCGCGTTTGTGAGA...GGCAGATTCACCATCTCAAGAGATGATTCCAAAAGCATCGCCTATCTGCAATTGAACAGCCTGGAAACCGACGACACAGGCGTCTATTACTGT"
 [7,] "GATTACGCCGCGTTTGTGAGA...GGCAGATTCACCATCTCAAGAGATGATTCCAAAAACATCGCCTATCTGCAATTGAACAGCCTGAAAACCGAGGACACAGGCGTCTATTACTGT"
 [8,] "GATTACGCCGCGTTTGTGAGA...GGCAGATTCACCATCTCAAGAGATGATTCCAAAAACATCGCCTATCTGCAATTGAACAGCCTGAAAACCGAGGACACAGGCGTCTATTACTGT"
 [9,] "GATTACGCCGCGTTTGTGAGA...GGCAGATTCACCATCTCAAGAGATGATTCCAAAAACATCGCCTATCTGCAATTGAACAGCCTGAAAACCGAGGACACAGGCGTCTATTACTGT"
[10,] "GATTACGCCGCGTTTGTGAGA...GGCAGATTCACCATCTCAAGAGATGATTCCAAAAGCATCGCCTATCTGCAATTGAACAGCCTGGAAACCGACGACACAGGCGTCTATTACTGT"
[11,] "GATTACGCCGCGTTTGTGAGA...GGCAGATTCACCATCTCAAGAGATGATTCCAAAAACATCGCCTATCTGCAATTGAACAGCCTGAAAACCGAGGACACAGGCGTCTATTACTGT"
[12,] "GATTACGCCGCGTTTGTGAGA...GGCAGATTCACCATCTCAAGAGATGATTCCAAAAGCATCGCCTATCTGCAATTGAACAGCCTGGAAACCGACGACACAGGCGTCTATTACTGT"
[13,] "GATTACGCCGCGTTTGTGAGA...GGCAGATTCACCATCTCAAGAGATGATTCCAAAAACATCGCCTATCTGCAATTGAACAGCCTGAAAACCGAGGACACAGGCGTCTATTACTGT"
[14,] "GATTACGCCGCGTTTGTGAGA...GGCAGATTCACCATCTCAAGAGATGATTCCAAAAACATCGCCTATCTGCAATTGAACAGCCTGAAAACCGAGGACACAGGCGTCTATTACTGT"
[15,] "GATTATGCCGCGTTTGTGAGA...GGCAGATTCACCATCTCAAGAGATGATTCCAAAAACATCGCCTATCTGCAATTGAACAGCCTGAAAACCGAGGACACAGGCGTCTATTACTGT"
[16,] "GATTACGCCGCGTTTGTGAGA...GGCAGATTCACCATCTCAAGAGATGATTCCAAAAACATCGCCTATCTGCAATTGAACAGCCTGAAAACCGAGGACACAGGCGTCTATTACTGT"
[17,] "GATTACGCCGCGTTTGTGAGA...GGCAGATTCACCATCTCAAGAGATGATTCCAAAAACATCGCCTATCTGCAATTGAACAGCCTGAAAACCGAGGACACAGGCGTCTATTACTGT"
[18,] "GATTACGCCGCGTTTGTGAGA...GGCAGATTCACCATCTCAAGAGATGATTCCAAAAACATCGCCTATCTGCAATTGAACAGCCTGAAAACCGAGGACACAGGCGTCTATTACTGT"
[19,] "GATTACGCCGCGTTTGTGAGA...GGCAGATTCACCATCTCAAGAGATGATTCCAAAAGCATCGCCTATCTGCAATTGAACAGCCTGGAAACCGACGACACAGGCGTCTATTACTGT"
[20,] "GATTACGCCGCGTTTGTGAGA...GGCAGATTCACCATCTCAAGAGATGATTCCAAAAACATCGCCTATCTGCAATTGAACAGCCTGAAAACCGAGGACACAGGCGTCTATTACTGT"

See also

IMGT-gapped region boundaries are defined in IMGT_REGIONS.